Hallo, Besucher der Thread wurde 486 aufgerufen und enthält 8 Antworten

letzter Beitrag von Karl W am

Kleine Zusammenfassung einiger Kurz-Foto-Sessions

  • Hallo Pilzfreunde,
    in der kalten Zeit hier eine kleine Zusammenfassung älterer Kurz-Foto-Sessions.

    04.08.2016: 3 Zufallsfunde im Garten

    Liebe Pilz-Freunde,
    folgende 3 Garten-Funde machte ich rein zufällig und zeige ich Euch natürlich gerne. Dabei wieder 2 tolle Erstfunde.

    Fundnummer: 2016-08-04-1620

    Morphologische Daten:

    Fundort: ca. 550 müNN. ca. N50, O12, auf Magerrasen (Garten)
    Fundzeit: 04.08.2016
    Wuchsform: paar-weise
    Hutform:
    konvex, im Zentrum hat ein Exemplar ein Loch
    Huthaut: braun, Zentrum dunkler, radialfaserig, Lamellen am Rand durchscheinend, fein, aber stark geschuppt
    Hygrophanität: ich stufte ihn als hygrophan ein, könnte jedoch auch nur "etwas aufhellend" gewesen sein
    Hutrand: sehr stumpf
    Lamellen:
    hellbraun, weiß bereift (Zystiden), Zwischenlamellen,
    Lamellenschneiden:
    stark bauchig,
    alt: wie ausgefranst wirkend
    Lamellen-Stielübergang:
    tief ausgebuchtet angewachsen
    , am Stiel leicht herablaufend, spinnwebenartige Fasern in der Ausbuchtung
    Stiel: braun, oben heller, stark bereift auf ganzer Länge
    Stielbasis: mit deutlichen bräunlichen Rhizoiden
    Fleisch:
    ohne Besonderheiten
    Größe: Hutdurchmesser ca. 0,5-0,7 cm, Stiellänge ca. 3,5-4 cm, Stieldurchmesser ca. 0,5 mm
    Sporenpulverfarbe: es kam nichts heraus
    Geruch: neutral
    Geschmack: nicht bewertet

    Mikroskopische Daten:

    HDS-Präparat:
    Schnallen:
    keine
    leptonioide Körnchen im HDS-Präparat: stark vorhanden
    Huthaare: büschelweise vorhanden, spitz zulaufend, septiert, inkrustiert
    Pileozystiden:
    zylindrisch bis leicht keulig, mehrgliedrig septiert, bräunlich inkrustiert (ist auf dem Bild leider nicht deutlich zu sehen)

    Breiten der Pileozystiden: ca. (6,3) 6,9 - 12,7 (13,2) µm
    Subkutis-Hyphen: inkrustiert

    Dieses Bild zeigt die typischen Haarbüschel der Art auf dem Hut, sowie die Pileozystiden und die starken leptonioide Körnchen.
    Das Bild zeigt leider die Inkrustierung der Pileozystiden nicht deutlich - sie war aber vorhanden.



    Lamellen-Präparat:
    Schnallen:
    keine

    leptonioide Körnchen im Lamellen-Präparat:
    stark vorhanden
    Cheilozystiden:
    zylindrisch bis breitkeulig, Kopf manchmal verschmälert, selten Spitze lang ausgezogen, Cheilozystiden oft mit braunem interzellulärem Pigment, auch leicht inkrustiert
    Messwerte ohne die mit lang ausgezogener Spitze:

    Präparat: Lamellenstück (Exsikkat) --> Ammo 10% --> Kongo NH3; Untersuchungsmedium: GSM; Messwertanzahl: n = 25
    Test auf Normalverteilung nach Anderson Darling: Länge: normalverteilt; Breite: normalverteilt; Q: normalverteilt
    Standardabweichung S. D.: von L × B: 7,9 × 2,5 µm; von Q: 0,5
    Median: von L × B: 42,3 × 14,5 µm; von Q: 2,9
    Arithmetischer Mittelwert Me: von L × B: 42,2 × 14,5 µm; von Q: 2,9
    Abmessungen nach t-Verteilungsverfahren mit 80%-Konfidenzintervall: für L × B: (23,4) 31,8 - 52,7 (60,2) × (10) 11,3 - 17,7 (19,8) µm; für Q: (1,9) 2,3 - 3,6 (4)
    Seltene Cheilozystiden mit lang ausgezogener Spitze: ca. 88 - 105 x 6,9 - 8 µm



    Sporen:
    heterodiametrisch (5)-6-7-(8)-eckig, knotig
    Maße:
    Präparat: aus Lamellenstück (Exsikkat) ausgewaschen; Untersuchungsmedium: GSM; Messwertanzahl: n = 85
    Test auf Normalverteilung nach Anderson Darling: Länge: normalverteilt; Breite: nicht normalverteilt; Q: normalverteilt
    Standardabweichung S. D.: von L × B: 0,9 × 0,4 µm; von Q: 0,1
    Median: von L × B: 11,5 × 6,4 µm; von Q: 1,8
    Arithmetischer Mittelwert Me: von L × B: 11,5 × 6,4 µm; von Q: 1,8
    Abmessungen nach Quantil-Verfahren mit 80%-Standardbereich: für L × B: (9,2) 10,3 - 12,5 (14,3) × (5) 6 - 6,9 (7,4) µm; für Q: (1,5) 1,6 - 2 (2,1)
    Abmessungen nach Quantil-Verfahren mit 90%-Standardbereich: für L × B: (9,2) 10,2 - 12,9 (14,3) × (5) 5,6 - 7,1 (7,4) µm; für Q: (1,5) 1,6 - 2 (2,1)

    Basidien:
    4-sporig (wenige 2-sporig), keulig, Lamellenschneide überwigend steril, Phaeobasidien vorhanden
    Maße: ca. 30 - 32 × 11 - 13 µm



    Stiel-Präparat:
    Ein wichtiges Bestimmungsmerkmal in diesem Fall sind die Inkrustierung und Septierung der Stielhaare (Kaulozystiden)
    Entoloma dysthaloides hat mehrfach septierte und deutlich braun inkrustierte Kaulozystiden
    Entoloma hirtum hat 1-2-fach septierte, dünnwandige, kaum inkrustierte Kaulozystiden

    Ergebnis der Untersuchung:
    Kaulozystiden:
    häufig, lang-keulig bis normal keulig, (1)-2-(3)-septiert, kaum oder gar nicht inkrustiert, sehr dünnwandig
    Maße: ca. 55 - 160 × 12 - 14,5 µm



    Schlüsselweg:
    nach Gröger Teil I ergab sich ein klarer und eindeutiger Schlüsselweg:
    A > A* > B > B* > C > C* > G > G* > I > K > K* > L > Teilschlüssel m S. 539 > 1 > 1a > 2 > 2b > 3 > 3b > 4 > 4b > 5 > 5a
    > Entoloma hirtum
    Gegenprüfung mit Pilzkompendium - keinen Widerspruch gefunden.
    Die sehr ähnliche Entoloma dysthaloides ist wegen der Kaulozystiden ausgeschlossen.

    Ein ganz toller Erstfund für mich: der Zottigfilzige
    Rötling (Entoloma hirtum):







    Fundnummer: 2016-08-04-1652

    Morphologische Daten:

    Fundort: ca. 550 müNN. ca. N50, O12, auf Wiese unter Kirschbaum, ausschließlich auf Kirschkernen
    Fundzeit: 04.08.2016
    Wuchsform: pro Kirschkern 1-3 Fruchtkörper - meist aber nur einer.
    Hutform:
    jung: eiförmig, alt: reißt am Rand ein, rollt sich hoch, Hut schirmt nicht auf
    Huthaut: Rand grau und etwas gestreift und gerieft (Lupe), zur Mitte hin weiß werdend,
    Zentrum bräunlich, gelbbraun beflockt
    Hygrophanität: nein
    Lamellen: dunkelbraun
    Lamellenschneiden:
    nicht bewertet
    Lamellen-Stielübergang:
    nicht bewertet
    Stiel: weiß, minimal befasert
    Stielbasis: ohne Besonderheiten
    Fleisch:
    ohne Besonderheiten
    Größe: Hutdurchmesser ca. 4 mm, Stiellänge ca. 3 cm, Stieldurchmesser ca. 1 mm
    Sporenpulverfarbe: nicht getestet
    Geruch: neutral
    Geschmack: nicht bewertet

    Diese spektakulären Tintlinge bestimmte Andreas Melzer (pilzmel). Vielen Dank dafür.
    Der Braunscheitelige Ästchen-Tintling (Coprinopsis pseudofriesii):









    Fundnummer: 2016-08-04-1640

    Morphologische Daten:

    Fundort: ca. 550 müNN. ca. N50, O12, auf Wiese (Garten)
    Fundzeit:
    04.08.2016
    Wuchsform:
    vereinzelt
    Hutform:
    glockig bis konvex, leichter Buckel aber keine Papille, alt: verbogen
    Huthaut: orangebraun, nach außen hin heller werdend, kahl erscheinend doch unter Lupe deutlich und stark filzhaarig was als "bereift" wahrnehmbar ist, matt, Lamellen nur jung etwas durchscheinend
    Hygrophanität: unsicher
    Hutrand: ohne Besonderheiten
    Lamellen: creme, mit Zwischenlamellen, keine Y-Gabeln
    Lamellenschneiden: stark bewimpert
    Lamellen-Stielübergang:
    tief ausgebuchtet angewachsen
    Stiel: orangebraun, stark bereift auf ganzer Länge, unteres Drittel reinweiß befilzt
    Stielbasis:
    knollig
    Fleisch:
    ohne Besonderheiten
    Größe: Hutdurchmesser ca. 0,5-1,1 cm, Stiellänge ca. 2-3 cm, Stieldurchmesser ca. 1-1,5 mm
    Sporenpulverfarbe: unter der Lupe sah ich deutlich orangerosa bestäubte Lamellen, beim Aussporen kam so wenig heraus dass die Farbe nicht zu deuten war.
    Geruch: deutlich nach Fisch
    Geschmack: nicht probiert


    Da das Sporenpulver wohl orangerosa ist, keine Papille vorhanden ist und auch die Lamellen nur bei einem jungen Exemplar leicht durchscheinen ist das der Gemeine Gurkenschnitzling (Macrocystidia cucumis):









    05.08.2016: 3 Funde unterwegs gemacht

    Auf dem Weg von A nach B bin ich wie immer mal hier, mal da stehen geblieben. Wieder fand ich viele Pilze - die 3 schönsten Funde zeig ich Euch...
    Los geht's...

    Fundnummer: 2016-08-05-1505

    Morphologische Daten:

    Fundort: ca. 550 müNN. ca. N50, O12, auf steinigen, sandigen und lehmigen Boden unter einer Weide
    Fundzeit: 05.08.2016
    Wuchsform: einzeln
    Sporenkugel: 11 cm, graubraun
    Scheitelöffnung: graubraun gefranst bis gewimpert, Durchmesser ca. 1 mm
    Peristom-Hof: nicht vorhanden
    Sternlappen: 9 Stück, beige, mit minimalem rosa-stich
    Größe: Durchmesser ca. 2,5 cm,
    Sporenpulverfarbe: nicht beurteilt
    Geruch:
    pilzig
    Geschmack: nicht probiert

    Gewimperter Erdstern (Geastrum fimbriatum):





    Fundnummer: 2016-08-05-1541

    Morphologische Daten:

    Fundort: ca. 550 müNN. ca. N50, O12, auf Rasen (Garten)
    Fundzeit: 05.08.2016
    Wuchsform: gesellig
    Hutform:
    konvex bis stumpfkegelig, manchmal mit leichter Papille
    Huthaut: dunkelbraun, nach außen hin heller werdend, radialfaserig, Lamellen am Rand durchscheinend, im Zentrum haarfilzig
    Hygrophanität: ja, dadurch radiale helle Streifen entstehend
    Hutrand: kantig, bei einem jungen Exemplat etwas eingerollt, bei alten Exemplaren schartig
    Lamellen: graurosa, Zwischenlamellen
    Lamellenschneiden:
    bauchig, sehr fein behaart (Lupe)
    Lamellen-Stielübergang:
    sehr tief ausgebuchtet angewachsen
    , am Stiel leicht herablaufend
    Stiel: grau-braun, oben heller, kahl, unten etwas bereift, fest und steif aber hohl
    Stielbasis: knollig, mit weißem Mycelfilz
    Fleisch:
    ohne Besonderheiten
    Größe: Hutdurchmesser ca. 1,3-2 cm, Stiellänge ca. 4 cm, Stieldurchmesser ca. 1,5-2 mm
    Sporenpulverfarbe: rosa
    Geruch: mehlig
    Geschmack: nicht bewertet

    Mikroskopische Daten:

    HDS-Präparat:
    Schnallen:
    keine gefunden
    leptonioide Körnchen im HDS-Präparat: vorhanden
    Epikutis: flach liegende, dicht gepackte, zylindrische Hyphen mit leicht verdicktem Ende, Pigment intrazellulär (auch klumpig intrazellulär) und manchmal etwas epimembranär inkrustiert, keine Schnallen gefunden
    Breiten der Epikutis-Hyphen: ca. (2,9) 4 - 6,7 (9) µm



    Subkutis:
    hyaline Hyphen, zylindrisch, in weitem Abständen inkrustiert (was man nicht als Inkrustierung im allgemeinem Sinn deuten kann), keine Schnallen gefunden
    Breiten der Subkutis-Hyphen: ca. (1,8) 4 - 13 (18) µm



    Lamellen-Präparat:
    Schnallen:
    keine gefunden (mit Ausnahme an 2 Cheilozystiden)

    leptonioide Körnchen im Lamellen-Präparat:
    vorhanden



    Cheilozystiden:
    keulig bis spindelförmig (am häufigsten), auch ampullenförmig, auch gliedrig septiert, grünlich inkrustiert, an 2 Cheilozystiden waren an der Basis Schnallen vorhanden
    Messwerte Cheilozystiden:

    Präparat: Lamellenstück (Exsikkat) --> Ammo 10%; Untersuchungsmedium: GSM; Messwertanzahl: n = 16
    Test auf Normalverteilung nach Anderson Darling: Länge: normalverteilt; Breite: normalverteilt; Q: nicht normalverteilt
    Standardabweichung S. D.: von L × B: 8,3 × 2,3 µm; von Q: 1,6
    Median: von L × B: 44,5 × 10,4 µm; von Q: 4,2
    Arithmetischer Mittelwert Me: von L × B: 45,8 × 10,7 µm; von Q: 4,5
    Abmessungen nach Quantil-Verfahren mit 80%-Standardbereich: für L × B: (35,3) 36,3 - 55,2 (67,3) × (7) 8,5 - 13,8 (16) µm; für Q: (2,2) 3,5 - 5,1 (9,7)



    Basidien:

    4-sporig, keulig, keine schnellen gesehen aber das mag nichts heißen
    Maße: ca. 31 - 37,4 × 11 - 14,4 µm



    Sporen:
    variabel isodiametrisch (am häufigsten – siehe q-Distribution-Diagramm) bis schwach hetereodiametrisch, 5 oder 6-eckig, Ecken nicht ausgeprägt
    Maße:
    Präparat: aus Lamellenstück (Exsikkat) ausgewaschen; Untersuchungsmedium: GSM; Messwertanzahl: n = 41
    Test auf Normalverteilung nach Anderson Darling: Länge: normalverteilt; Breite: normalverteilt; Q: normalverteilt
    Standardabweichung S. D.: von L × B: 0,7 × 0,6 µm; von Q: 0,1
    Median: von L × B: 9,8 × 7,7 µm; von Q: 1,3
    Arithmetischer Mittelwert Me: von L × B: 9,8 × 7,8 µm; von Q: 1,3
    Abmessungen nach t-Verteilungsverfahren mit 80%-Konfidenzintervall: für L × B: (8,4) 8,8 - 10,8 (11,6) × (6,8) 7 - 8,5 (9,6) µm; für Q: (1,1) 1,1 - 1,4 (1,5)
    Abmessungen nach t-Verteilungsverfahren mit 90%-Konfidenzintervall: für L × B: (8,4) 8,6 - 11 (11,6) × (6,8) 6,8 - 8,8 (9,6) µm; für Q: (1,1) 1,1 - 1,4 (1,5)



    Schlüssel-Weg:
    Gröger Teil I - S. 478
    A > A* > B > B* > C > C* > G > H > Teilschlüssel d bis l S. 513 > e > 1b > 3 > 3a > 4 > 4b > 6 > 6b > Entoloma pratulense
    Nachprüfung anhand "Entoloma (Basidiomycetes, Agaricales) of alpine habitats on the Hardangervidda near Finse, Norway, with a key including species from Northern Europe and Greenland": Geruch war bei meinem nicht neutral, Schnallen waren bei mir nur an den Cheilozystiden zu finden, ansonsten keine Widersprüche.
    Aber: Nachprüfung nach FE5a: Cheilozystiden Form passt nicht, Habitus (vor allem Stiel) anders

    A > A* > B > B* > C > C* > G > H > Teilschlüssel d bis l S 513 > e > 1b > 3 > 3a > 4 > 4b > 6 > 6b > Entoloma langei nachprüfen: Cheilozystiden Form passt nicht

    A > A* > B > B* > C > C* > G > H > Teilschlüssel d bis l S 513 > d > 1 > 1b > 6 > 6a 7 > 7b > 8 > 8b (Geruch im Schlüssel falsch) 9 > 9b > 10 > 10a > Entoloma tenellum (Cheilos anders)
    Pilzkompendium 360: Sporen mit ausgeprägten Ecken stimmt nicht, Cheilozystidenform stimmt nicht --> kann nicht sein.

    A > A* > B > B* > C > C* > G > H > Teilschlüssel d bis l S 513 > e > 1a > 2 > 2b > Entoloma globuliferum --> passt nicht

    A > A* > B > B* > C > C* > G > H > Teilschlüssel d bis l S 513 > e > 1b > 3 > 3a > 4 > 4a > 5 > Entoloma canosericeum
    Der "deutlich befaserte Stiel" passt nicht, die Stieldicke passt nicht, "trocken stark befasert" passt nicht, "saprotroph im Laubwald" passt nicht, Habitus (vergleich mit Dähncke) passt nicht.

    A > A* > B > B* > C > C* > G > H > Teilschlüssel d bis l S 513 > f > 1 > 1b (eher nicht) > 2 > 2b > 5 > 5a > 6 > Entoloma kerokarpus (schnallen fehlen)
    Pilzkompendium 373 - Hutbeschreibung stimmt nicht, Lamellenfarbe passt nicht, Stielform passt nicht, Stielbereifung passt nicht --> kann nicht sein.

    A > A* > B > B* > C > C* > G > H > H* > Teilschlüssel a bis c S 486 > Teilschlüssel a > 1 > 1b > 2 > 2b > 5a > 6 > 6b > 8 > 8a > Entoloma pallideradicatum --> passt nicht

    A > A* > B > B* > C > C* > G > H > Teilschlüssel d bis l S 513 > l > 1b > 2 > 2b > 3 > 3b > 4 > 4b > Entoloma fernandae --> passt nicht

    FN II - Seite 517:
    1 > 2 > 3 > 4 > 5 > 6 > 9 > 10 > 11 > 12 > Key L p. 569 > 1 > 3 (Schnallen zwar wenig aber eben da) > 4 > Entoloma pratulense

    1 > 2 > 3 > 4 > 5 > 6 > 9 > 10 > 11 > 12 > Key L p. 569 > 1 > 3 (Schnallen zwar wenig aber eben da) > 4 > Entoloma langei --> siehe oben - kann nicht sein

    1 > 2 > 3 > 4 > 5 > 6 > 9 > 10 > 11 > 12 > Key L p. 569 > 1 > 2 > Entoloma tenellum --> siehe oben - kann nicht sein

    1 > 2 > 3 > 4 > 5 > 6 > 9 > 10 > 11 > Key J p. 553 (eher nicht) > 1 > 4 > 9 > 10 > 11 > 12 > 13 > 14 > 17 > 18 > 30 > 31 > 32 > Sackgasse

    1 > 2 > 3 > 4 > 5 > 6 > 9 > 10 > 13 (eher nicht) > 14 > Key O p. 575 > Sackgasse

    Ein optisch sehr ähnliche Kollektion ist hier zu sehen:
    http://www.pilzepilze.de/cgi-b…1.pl?noframes;read=215782

    Nach Prüfung aller alternativen bleibt nur eine Möglichkeit:
    der Almen-Glöckling (Entoloma cf pratulense) ??. Wegen der Unsicherheit führte ich eine Sequenzanalyse durch.
    Leider schlug die PCR mit den Standard-Rückwärtsprimer fehl, sodass nur ein unvollständiges Stück der ITS aus der Vorwärtsprimer-PCR vorhanden war. Das machte aber nichts, da ich ja kein Phylogramm erstellen, sondern eine eventuelle Bestimmung erzielen wollte. Nach Abgleich der ITS-Sequenz mittels Divergenzmatrix ergab sich folgende finale Sequenz:

    >2016_08_05_1541_Entoloma_spec
    AGGTGAACCTGCGGAAGGATCATTATTGAATTAAACGTGGGATGGGTTGATGCTGGCTTGTTCAAAGCATGTGCACATCCATTCTATCTTTAAACCCTCCTGTGCACCTTGTGTAGGCCTTGAACGAACAATCTGTCGAAGGGAAATCACTCTTCGGTGACCGAGACTGCTGCTGCATTTGCACAGCTGTTTTGTATATGTTCTTTCAAGGTTCTATGTTTCCCATTATAAAATACTGTAAAAGAATGTCCTTTTTATTGGCCTTCTGTGCCTTTAAACATAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGA

    Diese hat leider nur Identität mit einer einzigen Sequenz, nämlich 100% Identität mit LN850612.1 Entoloma velenovskyi.

    Nun waren die Fragen:
    a) kann Entoloma velenovskyi so kleine Sporen haben?
    b) Ich habe keine Vergleichssequenz für Entoloma pratulense. kann die ermittelte Sequenz Entoloma pratulense sein?

    Hierzu fragte ich natürlich Machiel Noordeloos, der mir mitteilte:
    "Es ist ja schon dass es gelungen ist ITS zu sequenzieren. Aber: was ist es. Falls es 100 % identische ist mit E. velenovskyi in Genbank/Unite, dann bedeutet es, dass es identisch ist mit Entoloma velenovskyi sensu Kokkonen, basiert auf einer identification von A. hausknecht, aber nicht perse von den Typus des Artes. Dieser Match sagt also wesentlich nichts...." "...Deiner Art ist deswegen noch immer Namenlos, bis wir einer Typus sequenz haben, oder, was in diesem Fall wahrscheinlicher ist, wir ein sequenz haben vom einer Epitypus, da das Typus von Velenovsky ist Alkoholmaterial in sehr schlechter Zustand und wird nie noch brauchbares DNA geben."

    Damit bleibt der Fund vorerst unbestimmt, bzw. momentan nur der Almen-Glöckling (Entoloma cf pratulense):









    Fundnummer: 2016-08-05-1600

    Morphologische Daten:
    Fundort:
    ca. 550 müNN. ca. N50, O12, auf Rasen
    Fundzeit:
    05.08.2016
    Wuchsform: gesellig
    Hutform:
    halbkugelig
    Huthaut: ockergelb, kahl
    Hygrophanität: nicht festgestellt
    Hutrand: ohne Besonderheiten
    Lamellen: braun, bauchig, mit Zwischenlamellen
    Lamellenschneiden: weißlich
    Lamellen-Stielübergang:
    angeheftet
    Stiel: ockergelb, wie ein Strohhalm aussehend, längsfaserig, fest und steif, manchmal verdreht, hohl, mit Mark gefüllt
    Stielbasis:
    knollig
    Fleisch:
    ockergelb
    Größe: Hutdurchmesser ca. 2-3 cm, Stiellänge ca. 3-5 cm, Stieldurchmesser ca. 1,5-2,5 mm
    Sporenpulverfarbe: braun
    Geruch: erdig und mehlig
    Geschmack: nicht probiert

    Das ist der Halbkugelige Ackerling (Agrocybe pediades):







    30.08.2016: 2 weitere Zufallsfunde im Garten

    Wieder machte ich im Garten folgende 2 Funde rein zufällig. Dabei 1 toller Erstfund (siehe weiter unten), welcher nicht ganz leicht zu bestimmen war.

    Fundnummer: 2016-08-30-1800
    Ein Standard: Schwärzender Saftling (Hygrocybe conica):







    Fundnummer: 2016-08-30-1811
    Morphologische Daten:

    Fundort: ca. 550 müNN. ca. N50, O12, auf Magerrasen (Garten)
    Fundzeit: 30.08.2016
    Wuchsform: 3 Exemplare am Standort
    Hutform:
    konvex
    Huthaut: graubraun, matt, stellenweise sehr fein feldrig aufgerissen
    Hygrophanität: ja
    Hutrand: kantig
    Lamellen: grau, Zwischenlamellen, Anastomosen am Grund
    Lamellenschneiden:
    deutlich bräunend
    Lamellen-Stielübergang:
    ausgebuchtet angewachsen (1 Exemplar nicht ausgebuchtet sondern gerade angewaschsen), am Stiel etwas herablaufend
    Stiel: oben braun, nach unten dunkelbraun werdend, minimal bereift, biegsam, längsfaserig, hohl, KEINE dunklen Schuppen am Stiel
    Stielbasis: weißfilzig, minimal knollig
    Fleisch:
    Farbe wie außen
    Größe: Hutdurchmesser ca. 0,6-1 cm, Stiellänge ca. 1,5-2 cm, Stieldurchmesser ca. 1,5 mm
    Sporenpulverfarbe: es kam sehr wenig heraus, deshalb unklar, aber Hellsporer (mikroskopisch bestätigt)
    Geruch: völlig neutral, auch zerrieben völlig neutral
    Geschmack: nicht bewertet

    Mikroskopische Daten:

    Lamellentrama:
    regulär bis irregulär

    Sporen:
    glatt, hyalin, nicht amyloid, mit Öltröpfchen
    Maße:
    Präparat: aus Lamellenstück (Exsikkat) ausgewaschen; Untersuchungsmedium: GSM; Messwertanzahl: n = 30
    Test auf Normalverteilung nach Anderson Darling: Länge: normalverteilt; Breite: normalverteilt; Q: normalverteilt
    Standardabweichung S. D.: von L × B: 0,42 × 0,29 µm; von Q: 0,09
    Median: von L × B: 5,12 × 3,27 µm; von Q: 1,56
    Arithmetischer Mittelwert Me: von L × B: 5,1 × 3,31 µm; von Q: 1,54
    Abmessungen nach Quantil-Verfahren mit 80%-Standardbereich: für L × B:
    (4,12) 4,48 - 5,61 (5,93) × (2,85) 2,94 - 3,64 (4,21) µm; für Q: (1,33) 1,43 - 1,64 (1,7)
    Abmessungen nach Quantil-Verfahren mit 90%-Standardbereich: für L × B:
    (4,12) 4,43 - 5,76 (5,93) × (2,85) 2,91 - 3,71 (4,21) µm; für Q: (1,33) 1,41 - 1,68 (1,7)
    Abmessungen nach t-Verteilungsverfahren mit 80%-Konfidenzintervall: für L × B:
    (4,12) 4,55 - 5,66 (5,93) × (2,85) 2,93 - 3,7 (4,21) µm; für Q: (1,33) 1,43 - 1,66 (1,7)
    Abmessungen nach t-Verteilungsverfahren mit 90%-Konfidenzintervall: für L × B:
    (4,12) 4,38 - 5,83 (5,93) × (2,85) 2,81 - 3,81 (4,21) µm; für Q: (1,33) 1,4 - 1,69 (1,7)

    Basidien:
    ca. 19 - 26 x 4 - 5,5 µm, 4-sporig

    Stielflocken:
    kurz (bis 50 µm lang gesehen)

    Stielhyphen:
    mit Schnallen



    HDS-Präparat:
    Zellen birnenförmig 9-22 µm breit, Pigment: intraparietal, Schnallen: keine gesehen





    Heraus kam eine Sensation (für mich zumindest ist es eine):
    Nach Schlüsselung mit Gröger, Nachprüfung aller bekannten Alternativen (hauptsächlich Pilzkompendiuim) bestimmte ich diesen Fund als

    Glimmeriger Samtschneckling (Camarophyllopsis hymenocephala):









    Das war's für heute....
    Beste Grüße
    Dieter

  • Hallo Dieter,


    was für schöne Erinnerungen an das Jahr 2016!

    Da freue ich mich schon sehr auf die nachfolgenden Jahre.:)


    Samtschnecklinge (Camarophyllopsis) kenne ich nur mit herablaufenden Lamellen.

    Deshalb kann ich mich mit C. hymenocephala nicht so recht anfreunden.


    Liebe Grüße vom Nobi


    Nur wer gegen den Strom schwimmt, kann erkennen, wieviel Unrat mit dem Strom schwimmt. (Frank Richter?)

    Chips: 88 nach diversen Verlusten - Spende für APR 2015 - 5 verdiente Chips für Emil + 3 Chips von Sarah - 5 EM-Wetteinsatz - 3 APR 2016 - 10 APR 2017 (Einsatz) + 18 APR 2017 (Gewinn).

  • Hallo RudiS,

    nein, Du hast etwas falsch eingestellt, sie laden alle gleichzeitig, ohne einen einzigen Mouseklick.

    Melde Dich dazu zuerst an, dann gehe hier her:
    https://www.pilzforum.eu/sc-user-image-whitelist/
    Persönliche Whitelist (Permanent)
    Dort musst Du "www.nocrotec.com" freigeben, indem Du ein Bild anklickst und den Haken in der Checkbox "Diese Einstellung merken" und "Speichern" klickst.
    @Admins: Oder vielleicht könntet ihr ja meine Domain zu der Globalen Whitelist hinzufügen... ? Mein Sicherheitszertifikat ist aktiv und aktuell.

    Beste Grüße

    Dieter

  • sieht nach sehr viel Arbeit aus. Leider ohne Bilder.

    Wenn ich angemeldet bin, sehe ich alle Bilder, Rudi!

    Wenn nicht, kann ich sie auch nicht sehen.


    Eine Alternative zum Samtschneckling habe ich momentan leider nicht, Dieter.


    LG, Nobi


    Nur wer gegen den Strom schwimmt, kann erkennen, wieviel Unrat mit dem Strom schwimmt. (Frank Richter?)

    Chips: 88 nach diversen Verlusten - Spende für APR 2015 - 5 verdiente Chips für Emil + 3 Chips von Sarah - 5 EM-Wetteinsatz - 3 APR 2016 - 10 APR 2017 (Einsatz) + 18 APR 2017 (Gewinn).

  • Hallo Dieter, hallo Nobi,


    danke für Eure Hilfestellung. Klappt tatsächlich. Wäre schade um die viele Arbeit, wenn man nix sieht.


    EDIT: Der Kirschkerntintling gefällt mir besonders gut.


    Grüßle

    RudiS

  • Hallo Dieter,

    ich bewundere immer wievie Arbeit Du Dir mit Deinen Funden machst. Zu Camarophyllopsis muss ich mich jedoch Nobi anschließen. Neben dem Lamellenansatz passt auch die Anwesenheit von Schnallen nicht. Hinzu kommt, das nur eine Art in der Gattung nämlich C. schulzeri so helle Lamellen hat und die hat eine andere Huthautstruktur und subglobose Sporen. Leider kann ich Dir momentan keine Alternative nennen. Hellsporer mit glatten, inamyloiden Sporen und hymeniformer Huthaut ohne Zystiden findest Du noch bei Dermoloma, aber da sind die Sporen gewöhnlich größer.

    LG Karl

    • Gäste Informationen
    Hallo, gefällt Dir das Thema und willst auch Du etwas dazu schreiben, dann melde dich bitte an.
    Hast Du noch kein Benutzerkonto, dann bitte registriere dich, nach der Freischaltung kannst Du das Forum uneingeschränkt nutzen.